Singular Genomics-Specific Blocking Oligos

A: Yes, Singular Genomics-specific blockers from IDT are available.

To request hybrid capture blocking oligos from IDT specific for libraries compatible with the G4 Sequencing Platform, please email ngsdesign@idtdna.com and include the following sequences:

ACAAAGGCAGCCACGCACTCCTTCCCTGTXXXXXXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCT/3block

CTCCAGCGAGATGACCCTCACCAACCACTXXXXXXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT/3block

NOTE: Blocking oligos are made and shipped as 25 reaction aliquots (IDT suggests 1 μL = 1 reaction). If you need more, request multiples of 25. Oligos arrive lyophilized, and IDT recommends resuspension in IDTE pH. 8.0 (10 mM Tris, pH 8.0, 0.1 mM EDTA).